Klf6 Antibody Rat

Lab Reagents

Human IgG antibody Laboratories manufactures the klf6 antibody rat reagents distributed by Genprice. The Klf6 Antibody Rat reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact rat Antibody. Other Klf6 products are available in stock. Specificity: Klf6 Category: Antibody Group: Rat

Rat information


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA23492 50 ul
EUR 334
Description: Mouse polyclonal to KLF6


PVTH0011 2 ug
EUR 345

Anti-KLF6 SV1 Antibody

STJ501555 100 µg
EUR 476

Klf6 ORF Vector (Rat) (pORF)

ORF069093 1.0 ug DNA
EUR 506

KLF6 Rabbit pAb

A10011-100ul 100 ul
EUR 308

KLF6 Rabbit pAb

A10011-200ul 200 ul
EUR 459

KLF6 Rabbit pAb

A10011-20ul 20 ul
EUR 183

KLF6 Rabbit pAb

A10011-50ul 50 ul
EUR 223

KLF6 Blocking Peptide

DF13114-BP 1mg
EUR 195

KLF6 cloning plasmid

CSB-CL859936HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacag
  • Show more
Description: A cloning plasmid for the KLF6 gene.

KLF6 cloning plasmid

CSB-CL859936HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 783
  • Sequence: atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacag
  • Show more
Description: A cloning plasmid for the KLF6 gene.

anti-KLF6 (1A9)

LF-MA10159 100 ug
EUR 363
Description: Mouse monoclonal to KLF6

Anti-KLF6 (3C4)

YF-MA12504 100 ug
EUR 363
Description: Mouse monoclonal to KLF6

Polyclonal KLF6 Antibody (N-term)

AMM08636G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLF6 (N-term). This antibody is tested and proven to work in the following applications:

Monoclonal KLF6 Antibody, Clone: 4C7D6

APR17802G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human KLF6. The antibodies are raised in Mouse and are from clone 4C7D6. This antibody is applicable in WB and IHC, FC, ICC, E

Anti-KLF6 SV1 Antibody BIOTIN

STJ501556 100 µg
EUR 586